View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8367_low_8 (Length: 202)
Name: NF8367_low_8
Description: NF8367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8367_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 35881485 - 35881668
Alignment:
| Q |
1 |
tttatcaatagtactttaacacctaaactcgatagaaatattaattgaag-aatttgaaatgcataagaatgagannnnnnnnnnnnnnnngttggaaag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
35881485 |
tttatcaatagtactttaacacctaaactcgatagaaatattaattgaaggaatttgaaatggataagaatgagattttattttattttttgttggaaag |
35881584 |
T |
 |
| Q |
100 |
aataagaatgaaatatatttacctcctttgcactttcaaaattcaaaaggagaagggtgctttagaagaagatgagaaaaaggg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35881585 |
aataagaatgaaatatatttacctcctttgcactttcaaaattcaaaaggagaagggtgctttagaagaagatgagaaaaaggg |
35881668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University