View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8368_high_22 (Length: 220)
Name: NF8368_high_22
Description: NF8368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8368_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 203
Target Start/End: Complemental strand, 39014608 - 39014417
Alignment:
| Q |
13 |
tttggtgtttcaagattggggtatatatgtaataagaggataatatagtgtggtcagttagttagacttttcgtaattactatgatttcctaagtatatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014608 |
tttggtgtttcaagattggggtatatatgtaataagaggataatatagtgtggtaagttagttagacttttcgtaattactatgatttcctaagtatatt |
39014509 |
T |
|
| Q |
113 |
atttccg-ggggtaagccattaataatatcctttgtattgtcgattaaatgattaatatttgtaatagcaatgcttattttttgtgttattt |
203 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39014508 |
atttccggggggtaggccattaataatatcctttgtattgtcgattaaatgattaatatttgtaatagcaatgcttattttttgtgttattt |
39014417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University