View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8368_high_4 (Length: 680)
Name: NF8368_high_4
Description: NF8368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8368_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 17027105 - 17026959
Alignment:
| Q |
16 |
gttgttcctcatgggtttaagaatacgatgacccatattaaggcgcttgaaaagtgagtcgagatgaacaccaagggactacatttattggagagtgtgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
17027105 |
gttgttcctcatgggtttaagaatacaatgacccatattaaggcgcttgaaaagggactcgagatgaacaccaatggactacatttattg--gagtgtgg |
17027008 |
T |
 |
| Q |
116 |
ttgatggagaaatattcaccctagatggttttgaggacgagaaagacga |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17027007 |
ttgatggagaaatattcaccctagatggttttgaggacgagaaagacga |
17026959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University