View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8368_low_21 (Length: 315)
Name: NF8368_low_21
Description: NF8368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8368_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 202 - 298
Target Start/End: Original strand, 25963428 - 25963524
Alignment:
| Q |
202 |
tggtgtcgccgccaccagaacctagagttgctgtagtcgtatttctcttgaaaggcagatcgtttcttctcggccgccgttgcgcttccgtcggaga |
298 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||| | |||||||||||||| |
|
|
| T |
25963428 |
tggtgtcgccgccaccggaacctagagttgctgttgtcgtatttctcttgaaaggtagatcgttccttctcggccgccgtcgtgcttccgtcggaga |
25963524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 143
Target Start/End: Original strand, 27205189 - 27205310
Alignment:
| Q |
19 |
tgttcttcaaagggtattatagtataaatttactatggttaattaaataaggtgaatgaaagggtgaagctaattaattaaaagaactttttgtttggta |
118 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||| ||||| ||||||| |
|
|
| T |
27205189 |
tgttcttcaaagt-tattatagtgtaaatttactatggttgattaaataaggtgaatgaaagggtgaagccaattaatt-aaagaaattttt-tttggta |
27205285 |
T |
|
| Q |
119 |
taaggtaattaacaaatcttaatag |
143 |
Q |
| |
|
|||| |||||||||||| ||||||| |
|
|
| T |
27205286 |
taagttaattaacaaattttaatag |
27205310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University