View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8368_low_4 (Length: 680)

Name: NF8368_low_4
Description: NF8368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8368_low_4
NF8368_low_4
[»] chr4 (1 HSPs)
chr4 (16-164)||(17026959-17027105)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 3e-62
Query Start/End: Original strand, 16 - 164
Target Start/End: Complemental strand, 17027105 - 17026959
Alignment:
16 gttgttcctcatgggtttaagaatacgatgacccatattaaggcgcttgaaaagtgagtcgagatgaacaccaagggactacatttattggagagtgtgg 115  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||  ||||||||    
17027105 gttgttcctcatgggtttaagaatacaatgacccatattaaggcgcttgaaaagggactcgagatgaacaccaatggactacatttattg--gagtgtgg 17027008  T
116 ttgatggagaaatattcaccctagatggttttgaggacgagaaagacga 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
17027007 ttgatggagaaatattcaccctagatggttttgaggacgagaaagacga 17026959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University