View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8369_high_15 (Length: 323)
Name: NF8369_high_15
Description: NF8369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8369_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 20 - 301
Target Start/End: Original strand, 50601847 - 50602128
Alignment:
| Q |
20 |
ttgtaagaattgtgtcatggtagccgaattttatcaagggcaattgcttaatccatttgtctttgatttcatcagttagacgaattttatgaccatctaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50601847 |
ttgtaagaattgtgtcatggtagccgaattttatcaagggcaattgcttaatccatttgtctttgatttcgtcagttagacgaattttatgaccatctaa |
50601946 |
T |
 |
| Q |
120 |
ttgcagaatatgcttattcttaagcagatagtaaaatatatgcccaacttttgttatgtcaaaggcatattcagtttggccttctcatgaattgttagaa |
219 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50601947 |
tagcagaatatgcttattcttaagcagatagtagaatatatgcccaacttttgttatgtcaaaggcatattcagtttggccttctcatgaattgttagaa |
50602046 |
T |
 |
| Q |
220 |
tatttgtttgttgaatcgactaacatatcatcatcgaactccttaccgtatgcgatcgaaataaggtgcagacatctccctc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50602047 |
tatttgtttgttgaatcgactaacatatcatcatcgaactccttaccgtatgcgatcgaaataaggtgcagacatctccctc |
50602128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University