View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8369_high_16 (Length: 320)
Name: NF8369_high_16
Description: NF8369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8369_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 309
Target Start/End: Original strand, 31775493 - 31775784
Alignment:
| Q |
18 |
acatgttagcatttattttatttttatggcttgaagatcatcttatttaacccaaatacttgcttagggtgtgcttggaccaacatatcagaattgttta |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31775493 |
acatgttagcatttatcttatttttatggcttgaagatcatcttatttaacccaaatacttgcttagtgtgtgcttggaccaacatatcagaattgttta |
31775592 |
T |
 |
| Q |
118 |
tcatttggacaattgctctttaaacatctcaaaattgctcactttattaaaaatacattgtcgaaagttacaaccaaatcgatttttaacacataaaaag |
217 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31775593 |
tcatttggacaattgctttttagacatctcaaaattgctcactttactaaaaatatattgtcgaaagttacaaccaaatcgatttttaacacataaaaag |
31775692 |
T |
 |
| Q |
218 |
aaccgatcaagagttacaatccgatcatgaatgaaattcagatgtctaaagagcaattgtctatcttttgcttatacactaaccctattcat |
309 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31775693 |
agccgatcaagagttacaatccgatcatgaacgaaattcagatgtctaaagagcaattgtctatcttttgcgtatacactaaccctattcat |
31775784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 19986991 - 19986940
Alignment:
| Q |
121 |
tttggacaattgctctttaaacatctcaaaattgctcactttattaaaaata |
172 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
19986991 |
tttggacaattgctatttaggcatctcaaaattgctcactttattgaaaata |
19986940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University