View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8369_high_17 (Length: 315)
Name: NF8369_high_17
Description: NF8369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8369_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 21 - 305
Target Start/End: Complemental strand, 15116329 - 15116045
Alignment:
| Q |
21 |
acatgagcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatttggtttggctttggtgcagtaattggtgcaggaatc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116329 |
acatgagcttaagaaacaaagtgagaatgaaatgaaaaaatgtctcaattggtgggacttgatttggtttggctttggtgcagtaattggtgcaggaatc |
15116230 |
T |
|
| Q |
121 |
tttgtgctaactggtcaagaagctcataaccatgcaggagcagcaatagttttatcctatgtagcttcaggaatatcagcaatgctttctgttttttgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116229 |
tttgtgctaactggtcaagaagctcataaccatgcaggagcagcaatagtcttatcctatgtagcttcaggaatatcagcaatgctttctgttttttgtt |
15116130 |
T |
|
| Q |
221 |
acacagaatttgccgttgaagttccagctgcaggtggttcatttgcttatctaagaattgaattaggtgactttgttgctttcat |
305 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15116129 |
acacagaattcgccgttgaagttccagctgcaggtggttcatttgcttatctaagaattgaattaggtgactttgttgctttcat |
15116045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University