View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8369_high_19 (Length: 290)
Name: NF8369_high_19
Description: NF8369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8369_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 46
Target Start/End: Original strand, 1341879 - 1341907
Alignment:
| Q |
18 |
aaatgaaccataaaacacacaattttaag |
46 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1341879 |
aaatgaaccataaaacacacaattttaag |
1341907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University