View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8369_high_20 (Length: 287)
Name: NF8369_high_20
Description: NF8369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8369_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 25 - 269
Target Start/End: Original strand, 25157177 - 25157421
Alignment:
| Q |
25 |
ctctatcaccatgcgcagagaaggtaattctaataacatgattaagaggatttatcattattttagttgacctaaagctccaaaattcttaaggtgacct |
124 |
Q |
| |
|
|||| ||||| ||||||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25157177 |
ctctgtcaccgtgcgcagagaaagtaatcctaataacatgattaagaggacatatcattattttagttgacctaaagctccaaaattcttaaggtgacct |
25157276 |
T |
 |
| Q |
125 |
ttgtatccctccatgcacgcttacaaagatcttagataaaaatttgatgaagacatttatttagtttattgagtttacattaacaaatagatttttattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25157277 |
ttgtatccctccatgcacgcttacaaagatcttagataaaaatttgatgaagacatttatttagtttattgagtttacattaacaaatagatttttattt |
25157376 |
T |
 |
| Q |
225 |
gtggtaaggttcttggtttatgatctatgttaataacttgttaaa |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25157377 |
gtggtaaggttcttggtttatgatctatgttaataacttgttaaa |
25157421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 171 - 258
Target Start/End: Original strand, 25151527 - 25151615
Alignment:
| Q |
171 |
atgaagacatttatttagtttattgagtttacatt----aacaaatagatttttatttgtggtaaggttcttggtttatgatctatgttaat |
258 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25151527 |
atgaagacattt--ttagtttattgagttcacatttaataacaaatagatttt-atttgttgtaaggttcttggtttatgatctatgttaat |
25151615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University