View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8370_high_15 (Length: 230)
Name: NF8370_high_15
Description: NF8370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8370_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 19 - 170
Target Start/End: Original strand, 30535527 - 30535678
Alignment:
| Q |
19 |
tataaatcatccaccataaagaccatcatactaacaacaatagttggacgcacaaccctatcaatgaatcgannnnnnnatcaattgaatcaacattcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||| | |||||||||| ||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
30535527 |
tataaatcatccaccataaagaccatcacactaacaacaattgttaaatgcacaaccctttcaataaatcgatttttttatcaattgagtcaacattcat |
30535626 |
T |
 |
| Q |
119 |
cagctagtttgtgcttatctcttatgatgcctttgcacctcatgctatttat |
170 |
Q |
| |
|
| ||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30535627 |
cggctagttggtgcttatctctaatgatgcctttgcacctcatgctatttat |
30535678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University