View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8370_high_5 (Length: 405)
Name: NF8370_high_5
Description: NF8370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8370_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 360; Significance: 0; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 19 - 386
Target Start/End: Complemental strand, 7156680 - 7156313
Alignment:
| Q |
19 |
agtcgccctatctagaagttcctccaactcgaatgcctagttatttcacaatgtatggctttggatatgatcattccagtgatacttacaaggtggtcgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156680 |
agtcgccctatctagaagttcctccaactcgaacgcctagttatttcacaatgtatggctttggatatgatcattccagtgatacttacaaggtggtcgc |
7156581 |
T |
 |
| Q |
119 |
ggtttcttggtatgaatctcttattaatggtaatagggctatgaaaactcaagtaaatgttcacaccatgggtaccgattattggagaaggattcaaacc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156580 |
agtttcttggtatgaatctcttattaatggtaatagggctatgaaaactcaagtaaatgttcacaccatgggtaccgattattggagaaggattcaaacc |
7156481 |
T |
 |
| Q |
219 |
catttcccttatcgttttcctaataccggaacaggaaatttcgttagtggaacttttaattggtttgaagcagaacatcgttttccttatacacgaagca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156480 |
catttcccttatcgttttcctaataccggaacaggaaatttcgttagtggaacttttaattggtttgaagcagaacatcgttttccttatacacgaagca |
7156381 |
T |
 |
| Q |
319 |
ttgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatggagggatgtct |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7156380 |
ttgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatggagggatgtct |
7156313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 319 - 377
Target Start/End: Complemental strand, 7174561 - 7174503
Alignment:
| Q |
319 |
ttgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatgga |
377 |
Q |
| |
|
|||||||| || ||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7174561 |
ttgtttctcttcatttggagaatgagtcttatggagagatattgcagcctgattatgga |
7174503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 363
Target Start/End: Complemental strand, 7160946 - 7160901
Alignment:
| Q |
318 |
attgtttcttttgatttggagacggagtcttttcgagagatattgc |
363 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
7160946 |
attgtttctcttgatttggagaaggagtcttatcgagagctattgc |
7160901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 317 - 378
Target Start/End: Complemental strand, 9825696 - 9825635
Alignment:
| Q |
317 |
cattgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatggag |
378 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||| | || |||||| ||||||||||||||||||| |
|
|
| T |
9825696 |
cattgtttctcttgatttggggacagagtcctatcaagagattttgcagcctgattatggag |
9825635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 378
Target Start/End: Complemental strand, 9820016 - 9819955
Alignment:
| Q |
317 |
cattgtttcttttgatttggagacggagtcttttcgagagatattgcagcctgattatggag |
378 |
Q |
| |
|
|||||||||| ||||||||| || ||||| | || |||||| ||||||||||||||||||| |
|
|
| T |
9820016 |
cattgtttctcttgatttggggagagagtcctatcaagagattttgcagcctgattatggag |
9819955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University