View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8370_low_21 (Length: 263)
Name: NF8370_low_21
Description: NF8370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8370_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 248
Target Start/End: Complemental strand, 40198083 - 40197861
Alignment:
| Q |
30 |
gtgggaaattgaaatgattaatgaaggaaaacgctaggtacgtgtattttcggcatcctttgtagaacttgcagcttctaaggcgtaatgattctgcact |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40198083 |
gtgggaaattgaaatgattaatgaaggaaaacgttaggtacgtgtattttcggcatcctttgtagaacttgcagcttctaaggcgtaatgattctgcact |
40197984 |
T |
 |
| Q |
130 |
ttcctccaagcatagcagctgcatcaatcaattcattcat----tcatgattttatttataaattaatcatcaatgaataacgagatgaagaatcagaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40197983 |
ttcctccaagcatagcagctgcatcaatcaattcattcattcattcatgattttatttataaattaatcatcaatgaataacgagatgaagaatcagaaa |
40197884 |
T |
 |
| Q |
226 |
ttgtgataagaacctgttggcgg |
248 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40197883 |
ttgtgataagaacctgttggcgg |
40197861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University