View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8370_low_24 (Length: 239)
Name: NF8370_low_24
Description: NF8370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8370_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 39901355 - 39901154
Alignment:
| Q |
17 |
atataataataacactagctaggtacgtaatacgtagcacatgtattgtgaattagtgctagtaatttatttgtgattgatgcagtcgttaaaacttagg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39901355 |
atataataataacactagctaggtacgta-------gcacatgtatcgtgaattagtgctagtaatttatttgtgattgatgcagtcgttaaaacttagg |
39901263 |
T |
|
| Q |
117 |
atgctaatgcatggggtttgttcaacaattcctggtgcaaaagcagcggcgacggaagcctcgacaatcaccaccagtgaaaccttcacctctgcatacc |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39901262 |
atgctactgcatggggtttgttcaacaattcctggtgcaaaagcagcggcgacggaagcctcgacaatcaccaccagtgaaaccttcacctctgcatacc |
39901163 |
T |
|
| Q |
217 |
gatgcacag |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
39901162 |
gatgcacag |
39901154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 137 - 225
Target Start/End: Complemental strand, 39905079 - 39904991
Alignment:
| Q |
137 |
ttcaacaattcctggtgcaaaagcagcggcgacggaagcctcgacaatcaccaccagtgaaaccttcacctctgcataccgatgcacag |
225 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| || ||||||||||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
39905079 |
ttcaacaatttctggtgcaaaagcagcggtgacggacaccccgacaatcaccaccaatgaaaccttcacccctgcataccgatccacag |
39904991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University