View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8371_high_12 (Length: 240)
Name: NF8371_high_12
Description: NF8371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8371_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 29052628 - 29052405
Alignment:
| Q |
1 |
ttgaaaattttcaaatacttgtggattttcgctgtcaaggtttaaatccatgtttcacgagttggagtgtgagcttgtgctcacacaatggctcttggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052628 |
ttgaaaattttcaaatacttgtggattttcgttgtcaaggtttaaatccatgtttcacgagttggagtgtgagcttgtgctcacacaatggctcttggtg |
29052529 |
T |
 |
| Q |
101 |
ccactgcatttacttggttctatttactggtgattaaactcaagtgattaatgagttttctttagcataaattgttcggaag-attgagnnnnnnnnaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
29052528 |
ccactgcatttacttggttctatttactgatgattaaactcaagtgattaatgagttttctttagcataaattgttcggaagaattgaatttttcttaga |
29052429 |
T |
 |
| Q |
200 |
tgaaacaattattgatcagatatc |
223 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
29052428 |
tgaaacaattattgatcggatatc |
29052405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University