View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8371_low_19 (Length: 243)
Name: NF8371_low_19
Description: NF8371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8371_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 47260875 - 47261085
Alignment:
| Q |
18 |
ggacagatgaacgtaacagtgccaataaaaagtacctgagaagagaagggtcataagcattcacatagttcagaatcataacaatcttgaagggtacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47260875 |
ggacagatgaacgtaacagtgccaataaaaagtacctgagaagagaagggtcataagcattcacatagttcagaatcataacaatcttgaagggtacttt |
47260974 |
T |
 |
| Q |
118 |
tcatctaagcgtctaaaatttgttggctaaatacttgagttagtagatttggttgggaacacaagcatatgattaatctgatatcctaagagaatggttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47260975 |
tcatctaagcgtctaaaatttgttggctagatacttgagttagtagatttggttaggaacacaagcatatgattaatctgatatcctaagagaatggttt |
47261074 |
T |
 |
| Q |
218 |
ctccaacttgt |
228 |
Q |
| |
|
| ||||||||| |
|
|
| T |
47261075 |
caccaacttgt |
47261085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University