View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8371_low_22 (Length: 235)
Name: NF8371_low_22
Description: NF8371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8371_low_22 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 45975487 - 45975721
Alignment:
| Q |
1 |
atcttttatattgcagttgaagcagcttcagataacaacttaaaaccatattgcaactagcgttcaataatatttgtgtgattaaatatgccatttttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45975487 |
atcttttatattgcagttgaagcagctgcagataacaacttaaaaccatattgcaactagcgttcattaatatttgtgtgattaaatatgccatttttgg |
45975586 |
T |
|
| Q |
101 |
ttatcaggtgagtgggtgcttgtcgtatacggataagataagtgatggattttacaacatactggggatgaatccgtatctgtgggtgatgtgcaatgac |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975587 |
ttatcaggtgagtgggtgcttgtcatatacggataagataagtgatggattttacaacatactggggatgaatccgtatctgtgggtgatgtgcaatgac |
45975686 |
T |
|
| Q |
201 |
gaggaagaaggtaagaagatacccactttgatggc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975687 |
gaggaagaaggtaagaagatacccactttgatggc |
45975721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 200
Target Start/End: Complemental strand, 28052935 - 28052879
Alignment:
| Q |
144 |
gatggattttacaacatactggggatgaatccgtatctgtgggtgatgtgcaatgac |
200 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||||| ||||||| ||||| |||||| |
|
|
| T |
28052935 |
gatggattttataacatattgggaatgaatccgtatttgtgggttatgtgtaatgac |
28052879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University