View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8371_low_9 (Length: 380)
Name: NF8371_low_9
Description: NF8371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8371_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 43919118 - 43918756
Alignment:
| Q |
1 |
atgtgatggtggaaaaggagaataatcatcgcaagtggttaggatagaaacccctcaaagtccatatatatcttatagaaccgaaccggtcagattcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43919118 |
atgtgatggtggaaaaggagaataatcatcgcaagtggttaggatagaaacccctcaaagtccatatatatcttatagaaccgaaccggtcagattcttc |
43919019 |
T |
 |
| Q |
101 |
cttcagttcagcagaactagaaaatggttacatttacgtacctccaaatctaatactattacacaataatttccaaactttcagagatacccttttctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43919018 |
cttcagttcagcagaactagaaaatggttacatttacgtacctccaaatctaata---ttacacaataatttccaaactttcagagatacccttttctct |
43918922 |
T |
 |
| Q |
201 |
atttaattcatcttccttttttcgtttctactattttccaacaatagacaaaaatccctttgcaccttcttttgtttcaaccttttctgattttgaaagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918921 |
atttaattcatcttccttttttcgtttctactattttccaacaatatacaaaaattcctttgcaccttcttttgtttcaaccttttctgattttgaaagt |
43918822 |
T |
 |
| Q |
301 |
gaacctgttttcagttatgtgttctcaaacatcttcacctcgtttttctttctccaatgatgtttc |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918821 |
gaacctgttttcagttatgtgttctcaaacatcttcacctcgtttttctttctccaatgatgtttc |
43918756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University