View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8373_high_10 (Length: 430)
Name: NF8373_high_10
Description: NF8373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8373_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 353; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 34 - 406
Target Start/End: Complemental strand, 39139156 - 39138784
Alignment:
| Q |
34 |
agcagagagcactatgaaaagagaacacaagtgtggctcgttgctcaacaaccacctttaattcttgatgtgctaggtaaattaatgcacattcatgtac |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39139156 |
agcagagagcactatgaaaagagaacacaagtgtggctcgttgctcaacaaccacctttaattcttgatgtgctaggtaaattaatgcacattcatgtac |
39139057 |
T |
|
| Q |
134 |
actattacacacccagcttctttacttcacttcacatctgttttatcatcatcatcatcccctatgccgccactttttctgctgatcatgtcacagccac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39139056 |
actattacacacccagcttctttacttcacttcacatctgttttatcatcatcatcatcacctatgccgccactttttctgctgatcacgtcacagccac |
39138957 |
T |
|
| Q |
234 |
cactacctactctatgatcttgagcttccatctcataagctacagaaggagcagcaccaatttgtagcatgttccccgccactggaattggctccgtcaa |
333 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39138956 |
cactacctactctatgatcttgaccttccatctcatcagctacagaaggagcagcaccaatttgtagcatgttccccgccactggaattggctccgtcaa |
39138857 |
T |
|
| Q |
334 |
ttgttttccatctcgaggcggtgaaaacaccacgggcaggtaatgctccatctcacacgggaactttgagttc |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39138856 |
ttgttttccatctcgaggcggtgaaaacaccactggcaggtaatgctccatctcacacgggaactttgagttc |
39138784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University