View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8373_high_14 (Length: 377)
Name: NF8373_high_14
Description: NF8373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8373_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 368
Target Start/End: Complemental strand, 5733705 - 5733359
Alignment:
| Q |
18 |
ctatacttgtgacaaacccctatttattatgataaatgata-atgatctatgatatgatggtgcttatttgaataatgttcatgtagtcatgtttgccac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||| ||||| |||||||||||||||||| || |
|
|
| T |
5733705 |
ctatacttgtgacaaacccctatttattatgataa-tgatctatgat--atgatatgatggtgcttatttggataatcttcatgtagtcatgtttgtcat |
5733609 |
T |
|
| Q |
117 |
gtaatggttacactcagttcttcggtttacacaacagtgaagacgtgcatgtgctcttattcttaaggggagttcttattctggatacgatctcactaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5733608 |
gtaatggttacactcagttcttcggtttacacaacagtgaagacgcgcatgtgctcttattcttaaggggagttcttattctggatacgatctcactaac |
5733509 |
T |
|
| Q |
217 |
agttttcaaatcacactattatttcgacttgggtatcttattcgatacttctttactaggcttgggtaccaaaaaataacacgacaaccttcttgtnnnn |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5733508 |
agttttcaaatcacactattatttcgacttgggta--ttattcgatacttctttactaggcttgggtaccaaaaaataacacgacaaccttcttgtaaaa |
5733411 |
T |
|
| Q |
317 |
nnnggttggtattccattgattttcttctattgtggtcctgcatcttcttct |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5733410 |
aaaggttggtattccattgattttcttctattgtggtcctgcatcttcttct |
5733359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University