View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8373_high_24 (Length: 228)
Name: NF8373_high_24
Description: NF8373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8373_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 44988200 - 44988396
Alignment:
| Q |
1 |
gttcttctgagtaattctttcgttcaatttctagggtttagctctcatcgtctctccaaaccttcatcgtccgcacaccctcacctgctgccatggcgag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44988200 |
gttcttctgagtaattctttcgctcaatttctagggtttagctctcatcgtctctccaaaccttcatcgtccgcacaccctcacctgctgccatggcgag |
44988299 |
T |
 |
| Q |
101 |
taccaaagttcaaagggtcatgacccaacccattgtatgctttctcatcacactctttccctttcaacttctctttaacaacttaacctaatctccg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44988300 |
taccaaagttcaaagggtcatgacccaacccattgtatgctttctcatcacactctttccctttcaatttctctttaacaacttaacctaatctccg |
44988396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 24 - 160
Target Start/End: Original strand, 30881877 - 30882013
Alignment:
| Q |
24 |
tcaatttctagggtttagctctcatcgtctctccaaaccttcatcgtccgcacaccctcacctgctgccatggcgagtaccaaagttcaaagggtcatga |
123 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
30881877 |
tcaatttttagggtttagctctcatcgtctctccaaaccttcaccgtccgctcaccctcaccagctgccatggcgagcaccaaagttcagagggttatga |
30881976 |
T |
 |
| Q |
124 |
cccaacccattgtatgctttctcatcacactctttcc |
160 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30881977 |
cccaacccattgtacgctttctcaacacactctttcc |
30882013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University