View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8373_low_31 (Length: 224)
Name: NF8373_low_31
Description: NF8373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8373_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 32 - 207
Target Start/End: Original strand, 28283509 - 28283684
Alignment:
| Q |
32 |
ccacagggcccgctaccaaatattccactttcatatttcttgaagtcatcgttaatcgcgattgcaactgtaaccggctgttctgccactgcttctaata |
131 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28283509 |
ccacatggtccgctaccaaatattccactttcatatttcttgaagtcatcgttaatcgcgattgcaactgtaaccggctgttgtgccactgcttctaata |
28283608 |
T |
 |
| Q |
132 |
ggttttgttcgccgggtgatactattacataaccatcaatttttgcagcacggtcttttctgttgctaaggcatgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
28283609 |
ggttttgttcgccgggtgatactattacataaccatcaattttcgcagcacggtcttttttgttgctaaggcatgt |
28283684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University