View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8373_low_32 (Length: 221)
Name: NF8373_low_32
Description: NF8373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8373_low_32 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 30404017 - 30403801
Alignment:
| Q |
3 |
tattttttataaaatagttatatgcacctagaatacttgtaaagaacaagacattgattataacgtacaaattgtagagtttttgtctaactcgtaatat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
30404017 |
tattttttataaaatagttatatgcacctagaattcttgtaaagaacaaaacattgattataac--acaaattgtagagtgtttgtctaactcataatat |
30403920 |
T |
|
| Q |
103 |
atttaaacgtctgttagaatatcaacatcagaaatacaacatgcacaagcacccttttgtcaggcacaatcatctgcaatatgccaaaattatattttgg |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30403919 |
atttaaacatctgttagaatatcaacatctgaaatacaacatgcacaagcacccttttgtcaggcacaatcatctgcaatattccaaaattatattttgg |
30403820 |
T |
|
| Q |
203 |
gggaaacaatgtgatggcc |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30403819 |
gggaaacaatgtgatggcc |
30403801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University