View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8374_low_2 (Length: 258)
Name: NF8374_low_2
Description: NF8374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8374_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 4102986 - 4102746
Alignment:
| Q |
1 |
ccataagaatttggttttatatcattagcaaagtgaagaattcgctttacttttgaagtgttctctgtgtgagtgtgttctatgtttcaatgtgctttgg |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4102986 |
ccataagaatttgattttatatcattagcaaagtgaagaattcgctttacttttgaagtgttctctgtgtgagtgtgttctatgtttcaatgtgctttgg |
4102887 |
T |
 |
| Q |
101 |
atttaaaaatcataaaggtaattaaaagatacataagctaattaa-tatatattaaggtatttgnnnnnnngttttactttagttgtaattctatacggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4102886 |
atttaaaaatcataaaggtaattaaaagatacataagctaattaattatatattaaggtatttgtttttttgttttactttagttgtaattctatacggt |
4102787 |
T |
 |
| Q |
200 |
cttgtttctggtattgcaatgtctgttatgatttagatata |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4102786 |
cttgtttctggtattgcaatgtctgttatgatttagatata |
4102746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University