View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8374_low_3 (Length: 257)
Name: NF8374_low_3
Description: NF8374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8374_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 2369525 - 2369310
Alignment:
| Q |
18 |
atatggatgaacaactttcacattaatccaaagtatattacatatcaataaatgacaatgcagaaataattttttgaataaattaatcgccataatcttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2369525 |
atatggatgaacaactttcacattaatccaaagtatattacatattgataaatgacaatgcagaaataattttttgaataaattaatcgccataatcttt |
2369426 |
T |
 |
| Q |
118 |
tcaaccttcatgaaattgaaccaaatgaagtacaccaaaatatcacaaattattccacaactaacacaacatggatctgaaaggattattacatagtttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2369425 |
tcaaccttcatgaaattgaaccaaatgaagtacaccaaaatatcacaaattattccacaactaacacaacatggatctgaaagg---attacatagtttg |
2369329 |
T |
 |
| Q |
218 |
aaaatagacaaattacaaa |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2369328 |
aaaatagacaaattacaaa |
2369310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 65
Target Start/End: Complemental strand, 2363684 - 2363646
Alignment:
| Q |
27 |
aacaactttcacattaatccaaagtatattacatatcaa |
65 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2363684 |
aacaactttcacattaatccaaattatattacatatcaa |
2363646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University