View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8375_low_13 (Length: 308)
Name: NF8375_low_13
Description: NF8375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8375_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 14249615 - 14249782
Alignment:
| Q |
1 |
gctttccttccttcaatcactaaacaaataattcaccatattctaaaaccctaatcagttttcccacctaggaaaaccctaactctaattgaactcctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14249615 |
gctttccttccttcaatcactaaacaaataattcaccatcttctaaaaccctaatcagttttcccacctaggaaaaccctaactctaattgaactcctca |
14249714 |
T |
|
| Q |
101 |
attcaaggacttcatcactcaaaaataacaataacctaaccctaatttgactaacaaatattctactt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14249715 |
attcaaggacttcatcactcaaaaataacaataacctaaccctaatttgactaacaaatattctactt |
14249782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 296
Target Start/End: Original strand, 14249834 - 14249908
Alignment:
| Q |
222 |
taattcatatctatatatactaaaaacatgaataaagtagaaaacacggaattccccggttcaacgatcttcatc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||| |
|
|
| T |
14249834 |
taattcatatctatatatactaaaaacatgaataaagtacaaaacaccgaattccccgtttcaacgatcttcatc |
14249908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University