View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8377_high_4 (Length: 240)
Name: NF8377_high_4
Description: NF8377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8377_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 69 - 224
Target Start/End: Complemental strand, 46300595 - 46300440
Alignment:
| Q |
69 |
attaattaattaattactggatttcagtgtcaataggactagtgtggaacatgagtttatgatttaatccaagaaaagaacaatttcatttgtaatgtaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46300595 |
attaattaattaattactggatttcagtgtcaataggactagtgtggaacatgagtttatgatttaatccaagaaaagaacaatttcatttgtaatgtaa |
46300496 |
T |
|
| Q |
169 |
aatttatttatttttaattaatggagatctagctagctagggttcttactcttact |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46300495 |
aatttatttatttttaattaatggagatctagctagctagggttcttactcttact |
46300440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University