View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_high_21 (Length: 319)
Name: NF8379_high_21
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 15 - 298
Target Start/End: Original strand, 3351953 - 3352235
Alignment:
| Q |
15 |
tttggtgttctagaaaggtctagattcatatctgagctgttatcacttccattgctccaagaaccttcattttcnnnnnnnaggctaatagttccatttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3351953 |
tttggtgttctagaaaggtctagattcatatctgagctgttatcacttccattgctccaagaaccttcattttctttttttaggctaatagttccatttt |
3352052 |
T |
 |
| Q |
115 |
caaagcaatcccttttctttagagtttgtagctgcaaacaccatatatagtaaggtcttcatgaatgtatgtatcacattatnnnnnnnnngttattgta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
3352053 |
caaagcaatcccttttctttagagtttgtagctgcaaacaccatatatagtaaggtcttcatgaatgtatgtatcacaatataaaaaaaaa-ttattgta |
3352151 |
T |
 |
| Q |
215 |
ttcatatacagtaaggtctgcatgaaaatacggtcgcaattgcagttgggatgcgattgcgaaaatctttaaatcatttatatt |
298 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3352152 |
ttcatatatagtaaggtctgcatgaaaatacggttgcaattgcagttgggatgcgattgcgaaaatctttaaatcatttatatt |
3352235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University