View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_high_30 (Length: 241)
Name: NF8379_high_30
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 2 - 191
Target Start/End: Original strand, 2901431 - 2901621
Alignment:
| Q |
2 |
gaactgactaatttgagaggtccaattccactgttcaattgtgagagatctcatttaaaatcaaaggaaaactgtatatggactaacccattgaaattga |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||||||||| |||||| |||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
2901431 |
gaactgactaatttgagaggttcaattccactgtccacttgtgagagatctcgtttaaagtcaaagcaaaactgtatacagactaacccattgaaattga |
2901530 |
T |
|
| Q |
102 |
ctttaggggaatcaaacatgagatattgagaggagcacactcaaagcatttgagtttggctaaaacc-aaactatgtcgttttggttcata |
191 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||||||| || ||| ||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
2901531 |
ctttaggggaatcgaacatgaaatatttagaggagtaccctccaagcatttgagtttggctaaagccaaaactacgtcgttttggttcata |
2901621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 137
Target Start/End: Original strand, 9585584 - 9585669
Alignment:
| Q |
53 |
catttaaaatcaaaggaaaactgtatatggactaacccattgaaattgactttag-gggaatcaaacatgagatattgagaggagc |
137 |
Q |
| |
|
|||||||||||| || ||| || | |||||| | ||||||||||||||| |||| ||||||||||| ||| || ||||||||||| |
|
|
| T |
9585584 |
catttaaaatcagagtaaagctctgtatggattttcccattgaaattgacattagagggaatcaaacctgaaatcttgagaggagc |
9585669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 143
Target Start/End: Original strand, 43963986 - 43964022
Alignment:
| Q |
107 |
ggggaatcaaacatgagatattgagaggagcacactc |
143 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43963986 |
ggggaatcaaacatgagaccttgagaggagcacactc |
43964022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 140
Target Start/End: Complemental strand, 26608275 - 26608219
Alignment:
| Q |
85 |
taacccattgaaattgactttaggg-gaatcaaacatgagatattgagaggagcaca |
140 |
Q |
| |
|
|||| ||||||||||||| | |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
26608275 |
taactcattgaaattgacatcagggagaatcaaacatgagaccttgagaggagcaca |
26608219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University