View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_low_15 (Length: 434)
Name: NF8379_low_15
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 126 - 417
Target Start/End: Original strand, 2756948 - 2757239
Alignment:
| Q |
126 |
aataacgtatgaaaacaaatgaaataggtcttcctaactttgataataatcaaatcctagtcatatcatatttacaaagaattgggggaatttcacatga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756948 |
aataacgtatgaaaacaaatgaaataggtcttccaaactttgataataatcaaatcctagtcatatcatatttacaaagaattgggggaatttcacatga |
2757047 |
T |
|
| Q |
226 |
ttcatgcagttcaaaatcaaatttaataacatcaatgaatcaaagcaggaagatgaaataattgctaactcaagtctcaaagtatgatttcaaatattcc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757048 |
ttcatgcagttcaaaatcaaatttaataacatcaatgaatcaaagcaggaagatgaaataattgctaactcaagtctcaaagtatgatttcaaatattcc |
2757147 |
T |
|
| Q |
326 |
aatcagcagtcaattaaccataatcacagtcctcataaactttatacactaaagcaggtggtgtttctctaaattttgaaatacatctaaac |
417 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757148 |
aatcagcaatcaattaaccataatcacagtcctcataaactttatacactaaagcaggtggtgtttctctaaattttgaaatacatctaaac |
2757239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 23 - 61
Target Start/End: Original strand, 2756845 - 2756883
Alignment:
| Q |
23 |
gaaaattattatacaaagagagctaaagcaaggggaccc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2756845 |
gaaaattattatacaaagagagctaaagcaaggggaccc |
2756883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University