View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_low_23 (Length: 333)
Name: NF8379_low_23
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 11 - 318
Target Start/End: Original strand, 41922244 - 41922551
Alignment:
| Q |
11 |
cagagatcatgagtgtcaccaattactcttgcagttgggaaacaactcattgaaccactataacaagtatttaacaacccaatggcccctcgcacagctc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41922244 |
cagagatcatgagtgtcaccaattactcttgcagttgtgaaacaactcattaaaccactataacaagtatttaacaacccaatggcccctctcacagctc |
41922343 |
T |
|
| Q |
111 |
ttcatgtcttctatgaatggagcaatatttcattgtttcccccactatcatttcaaaatttatattatcatttcatcaaacttgtacatatttttcagta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922344 |
ttcatgtcttctatgaatggagcaatatttcattgtttcccccactatcatttcaaaatttatattatcatttcatcaaacttgtacatatttttcagta |
41922443 |
T |
|
| Q |
211 |
ttgcatgtgccatgcccatactcctaatattctttccaagaaaacggatcttaatgataatttatattttcattcaattgcaactgcacttaggtcaata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41922444 |
ttgcatgtgccatgcccatactcctaatattctttccaagaaaacggatcttaatgataatttatattttcattcaattgcaactgcacttaggtcaata |
41922543 |
T |
|
| Q |
311 |
atatatat |
318 |
Q |
| |
|
|||||||| |
|
|
| T |
41922544 |
atatatat |
41922551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University