View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_low_34 (Length: 242)
Name: NF8379_low_34
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 36506558 - 36506362
Alignment:
| Q |
17 |
agtacaagcaggtaaaatgtcaattaattccatttttctcttgcatgtttccatttcttgttatcaaattgaagtgtgtgtccataagtgtgctgctgtt |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36506558 |
agtacaagcaggtaaaatatcaattaattccatttttctcttgcatgtttccatttcttgttatcaa-ttgaagtgtgtgtccataagtgtgctgctgtt |
36506460 |
T |
 |
| Q |
117 |
tggtttttggtgttttttgttcttagcttctcagattttgctagttagcgtagagggtttgttgttgttagttgttcggcctctattctgtttttctg |
214 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
36506459 |
tggtttttgctgttttttgttcttagcttctcagattttgctagttggcgtagaggggttgttgttgttagttgtttggcctctgttctgtttttctg |
36506362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University