View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_low_42 (Length: 229)
Name: NF8379_low_42
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 209
Target Start/End: Complemental strand, 47404285 - 47404090
Alignment:
| Q |
14 |
tttggtgttggtacgtgcactaagtgattctagaggtcattttataaaagcaagaacagcttggtatgatggtgtacccactccaatggaagcagaaaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47404285 |
tttggtgttggtacgtgcactaagtgattctagaggtcattttataaaagcaaggacagcttggtatgatggtgtacccaatccaatggaagcagaaaca |
47404186 |
T |
 |
| Q |
114 |
tggggactcaaggaagttacgatttggcttgatgaaatggggatgtcaaatgtgttgatagaactagattgcaagctagttactgatggcataggg |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47404185 |
tggggactcaaggaagctacgatttggcttgatgaaatggggatgttaaatgtgtcgatagaactagattgcaagctggttactgatggcataggg |
47404090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 37 - 199
Target Start/End: Original strand, 40316085 - 40316247
Alignment:
| Q |
37 |
gtgattctagaggtcattttataaaagcaagaacagcttggtatgatggtgtacccactccaatggaagcagaaacatggggactcaaggaagttacgat |
136 |
Q |
| |
|
|||||| |||||| || ||||||||||| | |||||||| |||||||||||| |||||||||||||| ||| ||| |||||||||||| | || | |
|
|
| T |
40316085 |
gtgattatagaggccactttataaaagctttgatagcttggtttgatggtgtacctactccaatggaagcggaagcatagggactcaaggaggctattct |
40316184 |
T |
 |
| Q |
137 |
ttggcttgatgaaatggggatgtcaaatgtgttgatagaactagattgcaagctagttactga |
199 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||| || |||||||||||||| ||||| ||||| |
|
|
| T |
40316185 |
ttggcttggtgaaatggggacgccaaatgtgtcaattgaactagattgcaaactagtgactga |
40316247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 44 - 193
Target Start/End: Original strand, 22619373 - 22619522
Alignment:
| Q |
44 |
tagaggtcattttataaaagcaagaacagcttggtatgatggtgtacccactccaatggaagcagaaacatggggactcaaggaagttacgatttggctt |
143 |
Q |
| |
|
|||||| || ||| ||||||| | ||| |||||| |||||||||||| |||||||||||||||||| |||||||||||||||| | || |||||||| |
|
|
| T |
22619373 |
tagaggccactttgtaaaagctaagacaacttggtttgatggtgtacctactccaatggaagcagaagcatggggactcaaggaggctattctttggctt |
22619472 |
T |
 |
| Q |
144 |
gatgaaatggggatgtcaaatgtgttgatagaactagattgcaagctagt |
193 |
Q |
| |
|
| |||||||||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
22619473 |
ggtgaaatggggatgtcaaatgtgacaattgaactagattgcaaactagt |
22619522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 49 - 114
Target Start/End: Original strand, 45581425 - 45581490
Alignment:
| Q |
49 |
gtcattttataaaagcaagaacagcttggtatgatggtgtacccactccaatggaagcagaaacat |
114 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||| |||||||| |||||||| |||| ||||||| |
|
|
| T |
45581425 |
gtcatttaataaaagcaaggacaacttggtatgacggtgtaccttctccaatgcaagcggaaacat |
45581490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University