View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8379_low_43 (Length: 215)
Name: NF8379_low_43
Description: NF8379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8379_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 45669022 - 45669205
Alignment:
| Q |
14 |
gaagaatattcacacgtgaaagacattaaggaaggtgtatatattatgagcatttcattatgaaatttgaatttttatttcaataataaatactatgtga |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
45669022 |
gaagaatattcacacgtgaaagacaataaggaaggtgtatatattatgagcatttcattatgaaatttgaatttttattacaataataaata---tgtga |
45669118 |
T |
|
| Q |
114 |
tgtttcagtagagtacttgattgcttacaaaatcataacccatataggtctgaatctcgttgagtacccatcttcttcttgtccttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45669119 |
tgtttcagtagagtacttgattgcttacaaaatcataacccatataggtctgaatctcgttgagtacccatcttcttcttgtccttt |
45669205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University