View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8380_high_13 (Length: 218)
Name: NF8380_high_13
Description: NF8380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8380_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 52 - 198
Target Start/End: Original strand, 24300093 - 24300238
Alignment:
| Q |
52 |
caggggcggtgcattcgcattagagtttggatcaggaagatgatgggagaaaattttatgcaccgcattagggtttcattcctggtgtaatccggtatgg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24300093 |
caggggcggtgcattcgcattagagtttggatcaggaagacgatgggagaaaattttatgcaccgcattagggtttcattcctggtgtaatcc-gtatgg |
24300191 |
T |
 |
| Q |
152 |
gatttcattttgttgggcgcaaaccatgtcatttcgaggaggagctg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24300192 |
gatttcattttgttgggcgcaaaccatgtcatttcgaggaggagctg |
24300238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 202
Target Start/End: Original strand, 3693402 - 3693471
Alignment:
| Q |
133 |
ctggtgtaatccggtatgggatttcattttgttgggcgcaaaccatgtcatttcgaggaggagctgatgt |
202 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| | |||||||||| | |||| ||| ||||| |||||| |
|
|
| T |
3693402 |
ctggtgtaattcggtatgggatttcattttgttcgacgcaaaccatattattttgagcaggaggtgatgt |
3693471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 3701153 - 3701218
Alignment:
| Q |
133 |
ctggtgtaatccggtatgggatttcattttgttgggcgcaaaccatgtcatttcgaggaggagctg |
198 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||||||||| |||||||| || ||||| |
|
|
| T |
3701153 |
ctggtctaatccggtataagatttcattttgttcggcgcaaaccatgttatttcgagcagaagctg |
3701218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 195
Target Start/End: Original strand, 3685661 - 3685723
Alignment:
| Q |
133 |
ctggtgtaatccggtatgggatttcattttgttgggcgcaaaccatgtcatttcgaggaggag |
195 |
Q |
| |
|
|||||||||| ||||||| ||||| | ||| || |||||||||||||| |||||||| ||||| |
|
|
| T |
3685661 |
ctggtgtaattcggtatgagattttagtttattcggcgcaaaccatgttatttcgagcaggag |
3685723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University