View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8380_high_2 (Length: 344)
Name: NF8380_high_2
Description: NF8380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8380_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 329
Target Start/End: Complemental strand, 3629152 - 3628847
Alignment:
| Q |
18 |
gtttctgctaaatgcggagaagataacgctaaagataacggagacagttattgttatttcatcgatgacgtggcaaaatgccttaacgaaggtagttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629152 |
gtttctgctaaatgcggagaagataacgctaaagataacggagacagttattattatttcatcgatgacgtggcaaaatgccttaacgaaggtagttttg |
3629053 |
T |
|
| Q |
118 |
atgtcaatacgaatacatattcgatctcaacgagaaagaagagnnnnnnntcgaaatcgaattcgaatgagaaagaggaaatgttgatgttagtgttacc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
3629052 |
atgtcaatacgaatacatattcgatctcaacgagaaagaagagaaaa------aaatcgaattcgaatgagaaagaggaaatgttgacgttggtgttacc |
3628959 |
T |
|
| Q |
218 |
taatttgaagctgagagttgttcaggaagcgttaaggattgttttagaagtgattttcaagccgaatttctcgaggatatcgcatggttgtaggagtggg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3628958 |
taatttgaagctgagagttgttcaggaagctttaaggattgttttagaagtgattttcaagccgaatttctcgaggatatcgcatggttgtaggagtggg |
3628859 |
T |
|
| Q |
318 |
agaggacgtgtg |
329 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3628858 |
agaggacgtgtg |
3628847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University