View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8380_high_9 (Length: 244)
Name: NF8380_high_9
Description: NF8380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8380_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 49 - 161
Target Start/End: Original strand, 37145087 - 37145198
Alignment:
| Q |
49 |
tgtggctaagcgagctgaagcggcttaggtgagctgaaaagtacttcaggcgaagaaatcactgtggctaaacgagccgcttcatggcttagcgtggatc |
148 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
37145087 |
tgtggctaagcgagctga-gcggcttaggtgagcttaaaagtacttcaggtgaagaaatcattgtggctaagcgagcttcttcatggcttagcgtggatc |
37145185 |
T |
 |
| Q |
149 |
cacttttctgcca |
161 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37145186 |
cacttttctgcca |
37145198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University