View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8380_low_4 (Length: 290)
Name: NF8380_low_4
Description: NF8380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8380_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 40 - 273
Target Start/End: Original strand, 3929199 - 3929432
Alignment:
| Q |
40 |
tgtaacataccagacacatgtgtttttgtcacgaaatgtttgacaaattataacagtatcacttaataagatttaaaagacttatgtgagacaaaacttg |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3929199 |
tgtaacataccagacacatgtgtttttgtcacgaaatgtttgacaaattataacagtatcacttaataagatttaaaagacttatgtgagacaaaacttg |
3929298 |
T |
 |
| Q |
140 |
aaaacatattttgtttttcgttaagagttattagcaacttcaataaattgcaatattggcaaaatataagcttacatcagatggttggtggcaatattgg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3929299 |
aaaacatattttgtttttcgttaagagttattagcaacttcaataaattgcaatattggcaaaatataagcttacatcagatggttggtgacaatattgg |
3929398 |
T |
 |
| Q |
240 |
actattggtactaatgcacaaggaatgatgaaat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3929399 |
actattggtactaatgcacaaggaatgatgaaat |
3929432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University