View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8380_low_5 (Length: 283)
Name: NF8380_low_5
Description: NF8380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8380_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 106 - 267
Target Start/End: Complemental strand, 40115774 - 40115613
Alignment:
| Q |
106 |
aaactgaaaaaaccaatatcaaagattttcctaatacttctctttcactcaacctttttcattcaatcttttatcatcttcacaagtttcttttcatatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115774 |
aaactgaaaaaaccaatatcaaagattttcctaatacttctctttcactcaacctttttcattcaatcttttatcatcttcacaagtttcttttcatatt |
40115675 |
T |
 |
| Q |
206 |
caacttctgttgtgaattgcatagcaatctttcttttttaggtctcttcaaataatggtttt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115674 |
caacttctgttgtgaattgcatagcaatctttcttttttaggtctcttcaaataatggtttt |
40115613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 40115879 - 40115844
Alignment:
| Q |
1 |
ttgaagcggagaggtcaagtaactgtaaaatagcag |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40115879 |
ttgaagcggagaggtcaagtaactgtaaaatagcag |
40115844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University