View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8380_low_9 (Length: 244)

Name: NF8380_low_9
Description: NF8380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8380_low_9
NF8380_low_9
[»] chr2 (1 HSPs)
chr2 (49-161)||(37145087-37145198)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 49 - 161
Target Start/End: Original strand, 37145087 - 37145198
Alignment:
49 tgtggctaagcgagctgaagcggcttaggtgagctgaaaagtacttcaggcgaagaaatcactgtggctaaacgagccgcttcatggcttagcgtggatc 148  Q
    |||||||||||||||||| |||||||||||||||| |||||||||||||| |||||||||| ||||||||| |||||  |||||||||||||||||||||    
37145087 tgtggctaagcgagctga-gcggcttaggtgagcttaaaagtacttcaggtgaagaaatcattgtggctaagcgagcttcttcatggcttagcgtggatc 37145185  T
149 cacttttctgcca 161  Q
    |||||||||||||    
37145186 cacttttctgcca 37145198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University