View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8381_high_7 (Length: 324)
Name: NF8381_high_7
Description: NF8381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8381_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 9 - 306
Target Start/End: Complemental strand, 29132296 - 29131999
Alignment:
| Q |
9 |
tggtggtggtagtggacttactttcatcattgtacctgatgaattcactgttggaaggccaggaccttggcttggtatgcttaatgatgcttgcgagagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29132296 |
tggtggtggtagtggacttactttcatcattgtacctgatgaattcactgttggaaggccaggaccttggcttggtatgcttaatgatgcttgcgagagc |
29132197 |
T |
|
| Q |
109 |
gattataaagctgttgcaattgagtttgatacacgagaaaatccagaattcggtgatccaaatgataaccatgttggtataaatttaggtagcatagtat |
208 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29132196 |
gattataaagccgttgcaattgagtttgatacacgagaaaatccagaattcggtgatccaaatgataaccatgttggtataaatttaggtagcatagtat |
29132097 |
T |
|
| Q |
209 |
ctactaaaattatcaatgtttcagatattggagtttctcttaaggatggttttgttcaccatgcttggattgattatgatggtcctcgaagacgaatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29132096 |
ctactaaaattatcaatgtttcagatattggagtttctcttaaggatggttttgttcaccatgcttggattgattatgatggtcctcaaagacgaatt |
29131999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University