View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8381_low_16 (Length: 330)
Name: NF8381_low_16
Description: NF8381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8381_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 16 - 312
Target Start/End: Original strand, 48483535 - 48483830
Alignment:
| Q |
16 |
ggacatcaaacatatgccaaaggaaacttatgaacacatcataaatttataagttcatccaaacacgactataagttcttatgttataaaataatcacaa |
115 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483535 |
ggacttcaaacataagccaaaggcaacttatgaacacatcataaatttataagttcatccaaacacgactataagttcttatgttataaaataatcacaa |
48483634 |
T |
|
| Q |
116 |
ataagctttcaaaaagctcgtcaagatatcccaaaacatatttgtatgaggcatacaggtgaagttctccataactatgaaagtgagctaaattgattac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483635 |
ataagctttcaaaaagctcgtcaagatatcccaaaacatatttgtatgaggcatacaggtgaa-ttctccataactatgaaagtgagctaaattgattac |
48483733 |
T |
|
| Q |
216 |
atgcatagattggttagtacgtgattgagtcaagccaatcatgatatgaatggaaaattgcatatttctcactgaagaattattgcggtggatccat |
312 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48483734 |
atgcatagattggttagtacgtgatcgagtcaagccaatcatgatatgaatggaaaattgcatatttctcactgaagaattattgcggtggatccat |
48483830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University