View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8381_low_25 (Length: 241)
Name: NF8381_low_25
Description: NF8381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8381_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 40552451 - 40552307
Alignment:
| Q |
1 |
ccctcccaaatacgccaaattaccttcgctgccactttctgcagcctggcgttattcaacgtcaacgatggaagctcctcccgaaggttaccgcaagaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40552451 |
ccctcccaaatacgccaaattaccttcgctgccactttctgcagcctggcgttattcaacgtcaacgatggaagctcctcccgaaggttaccgcaagaac |
40552352 |
T |
|
| Q |
101 |
gttggaatctgtctcatcaatgatcaaaagaaggttcaatctctc |
145 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40552351 |
gttggaatctgtctcatcaataatcaaaagaaggttcaatctctc |
40552307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 145 - 236
Target Start/End: Complemental strand, 40552185 - 40552094
Alignment:
| Q |
145 |
cacaacacatgtgattagattcagctacgttgttaatttaaattactactggtctgtcacatgtcagtgtcactgtcgtgtctgatgtccat |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40552185 |
cacagcacatgtgattagattcagctacgttgttaatttaaattactactggtgtgtcacatgtcagtgtcactgtcgtgtctggtgtccat |
40552094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University