View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8381_low_29 (Length: 215)
Name: NF8381_low_29
Description: NF8381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8381_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 39771041 - 39770833
Alignment:
| Q |
1 |
catgaacacatttattgtatccctaacttcgctcaccttttcattggattccttgtttcatcacttgatgatatttttctgaacggtaacagttgtgggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39771041 |
catgaacacatttattgtatccctaacttcgctcaccttttcattggattccttgtttcatcagttgatgatatttttctgaacggtaacagttgtgggt |
39770942 |
T |
 |
| Q |
101 |
cagggagggaccattcaattttaagaaattgtgaggtcctaatctataatcatgcagacccctaagacaaggtaatcttgaaatgcttggcctattgcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39770941 |
cagggagggaccattcaattttaagaaattgtgaggtcctaatctataatcatgcagacccctaagacaaggtaatcttgaaatgcttggcctattgcac |
39770842 |
T |
 |
| Q |
201 |
tcttatatt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
39770841 |
tcttatatt |
39770833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University