View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8381_low_8 (Length: 421)
Name: NF8381_low_8
Description: NF8381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8381_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 11 - 404
Target Start/End: Original strand, 31890557 - 31890942
Alignment:
| Q |
11 |
cagagagactattgctaacatgctcaaatgaaacatgtggtgcatatcgtacaagtagtttcaacatttacatttataggctgtttggttcatttctann |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31890557 |
cagagagactattgctaacatgctcaaatgaaacatgtggtgcatatcgtacaagtagtttca-catttacatttataggctgtttggttcatttctatt |
31890655 |
T |
 |
| Q |
111 |
nnnnnnnnnccatcgataacccttcgagtttttaggggaaagagatccctcataatatgaagttcggctgtgaggtaaggataatcttaccaaaaattgt |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31890656 |
ttttt----ccctcgataacccttcgagtttttaggggaaagagatccctcataatctgaagttcggctgtgaggtaaggataatcttacaaaaaattgt |
31890751 |
T |
 |
| Q |
211 |
ttcccttaaaaatcgaacatggattctctcgaaagattcgtcattagtgaagctca-agttcaattgcttgattttcacatgtaaacttaatttctcaag |
309 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||| |||||| ||||||||| |||||||||||||| ||| ||| | |||||||||||||||||| |
|
|
| T |
31890752 |
tccccttaaaaatcgaacatgggttctctcgaaagattcatcattaatgaagctcatagttcaattgcttggtttccacgtctaaacttaatttctcaag |
31890851 |
T |
 |
| Q |
310 |
tctcaatgnnnnnnnaccgtgatttgttgaagctagatattcaagcttctccctaaacgtgtggcattcattgttcaaacaaccgctagactaaa |
404 |
Q |
| |
|
| |||||| ||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31890852 |
tttcaatgtttttttaccgtgattcgttgaagctagatattcaagcttctcactaaacgtgtgg----cattgttcaaacaaccgctagactaaa |
31890942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 327 - 369
Target Start/End: Complemental strand, 27068345 - 27068303
Alignment:
| Q |
327 |
cgtgatttgttgaagctagatattcaagcttctccctaaacgt |
369 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| |||||||| |
|
|
| T |
27068345 |
cgtgatttgttgaagctagacattcaagcatctcactaaacgt |
27068303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 266
Target Start/End: Complemental strand, 23796605 - 23796560
Alignment:
| Q |
221 |
aatcgaacatggattctctcgaaagattcgtcattagtgaagctca |
266 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
23796605 |
aatcgaacttggattctctcgaatgattcatcattggtgaagctca |
23796560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 328 - 372
Target Start/End: Original strand, 7427425 - 7427469
Alignment:
| Q |
328 |
gtgatttgttgaagctagatattcaagcttctccctaaacgtgtg |
372 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
7427425 |
gtgatttgatgacgctagatattcaagcttctcaccaaacgtgtg |
7427469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University