View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8382_high_17 (Length: 273)
Name: NF8382_high_17
Description: NF8382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8382_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 91 - 257
Target Start/End: Original strand, 8394828 - 8394994
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394828 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
8394927 |
T |
 |
| Q |
191 |
tgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394928 |
tgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
8394994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 91 - 257
Target Start/End: Complemental strand, 8406501 - 8406335
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406501 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
8406402 |
T |
 |
| Q |
191 |
tgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406401 |
tgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
8406335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 91 - 257
Target Start/End: Complemental strand, 8412621 - 8412455
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8412621 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
8412522 |
T |
 |
| Q |
191 |
tgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8412521 |
tgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
8412455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 91 - 257
Target Start/End: Complemental strand, 8434719 - 8434553
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8434719 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
8434620 |
T |
 |
| Q |
191 |
tgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8434619 |
tgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
8434553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 91 - 257
Target Start/End: Original strand, 8395071 - 8395237
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8395071 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaaaatgattactctcactgctacaaccatgtctggagttgcagc |
8395170 |
T |
 |
| Q |
191 |
tgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
257 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8395171 |
tgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttattctctgct |
8395237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 91 - 244
Target Start/End: Complemental strand, 8431646 - 8431496
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgcagc |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8431646 |
atcacaacattggcgaac---gtaacaactggaataatcttcttttgaactcaataaacatgattactctcactgctaagactatgtctggtgttgcagc |
8431550 |
T |
 |
| Q |
191 |
tgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctct |
244 |
Q |
| |
|
||||||||| ||||||| |||||||||| ||||| ||||||| || |||||||| |
|
|
| T |
8431549 |
tgtcacaagtggggaagttgcaccacttttggctctgaaactatcttctgctct |
8431496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 91 - 187
Target Start/End: Original strand, 8375379 - 8375475
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgc |
187 |
Q |
| |
|
|||| |||||||||||||| |||||||| ||||| | |||||| || ||||| || || ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8375379 |
atcaaaacattggcgaacagcgtaacaattggaacactcttctcttgaactccatcaacatgattactcttactgctacaaccatgtctggtgttgc |
8375475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 91 - 187
Target Start/End: Complemental strand, 8439724 - 8439628
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgc |
187 |
Q |
| |
|
|||| |||||||||||||| |||| ||| ||||| | |||||| || ||||| || || ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8439724 |
atcaaaacattggcgaacagcgtagcaattggaacactcttctcttgaactccatcaacatgattactcttactgctacaaccatgtctggtgttgc |
8439628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 91 - 187
Target Start/End: Complemental strand, 8417842 - 8417746
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcactgctacaaccatgtctggtgttgc |
187 |
Q |
| |
|
||||||||||| | |||| ||||||||| ||||| | |||||| || || || || || ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8417842 |
atcacaacatttgtgaactacgtaacaattggaacactcttctcttgaattccatcaacatgattactctcactgctacaaccatgtctggtcttgc |
8417746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 163
Target Start/End: Complemental strand, 8368884 - 8368812
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcac |
163 |
Q |
| |
|
|||| ||||||||||||||||| | || ||||||| |||||||||||||| || || ||||| |||||||| |
|
|
| T |
8368884 |
atcaaaacattggcgaacaacgcgataattggaatacccttctattaaactccatcaacatgatcactctcac |
8368812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 163
Target Start/End: Original strand, 8400526 - 8400598
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcac |
163 |
Q |
| |
|
|||| ||||||||||||||||| | || ||||||| |||||||||||||| || || ||||| |||||||| |
|
|
| T |
8400526 |
atcaaaacattggcgaacaacgcgataattggaatacccttctattaaactccatcaacatgatcactctcac |
8400598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 163
Target Start/End: Original strand, 8422103 - 8422175
Alignment:
| Q |
91 |
atcacaacattggcgaacaacgtaacaactggaataatcttctattaaactcaataaatatgattactctcac |
163 |
Q |
| |
|
|||| ||||||||||||||||| | || ||||||| |||||||||||||| || || ||||| |||||||| |
|
|
| T |
8422103 |
atcaaaacattggcgaacaacgcgataattggaatacccttctattaaactccatcaacatgatcactctcac |
8422175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University