View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8382_high_4 (Length: 471)
Name: NF8382_high_4
Description: NF8382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8382_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 419; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 419; E-Value: 0
Query Start/End: Original strand, 18 - 456
Target Start/End: Complemental strand, 35500250 - 35499812
Alignment:
| Q |
18 |
gatccggttcctgaatatccatccgggttaccgttgttctgtcaattaaccagctgcgaaggaaagctcgtggtaatgggtgggtgggacccagcgagtt |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35500250 |
gatccggttcctgagtatccatccgggttaccgttgttctgtcaattaaccagctgcgaaggaaagctcgtggtaatgggtgggtgggacccggcgagtt |
35500151 |
T |
 |
| Q |
118 |
acgaaccacttacggcggtgttcgtttacgatttccgaatgaatatatggcggagagggaaggatatgccggagaaacgttcgttctttgctaccgggtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35500150 |
acgaaccacttacggcggtgttcgtttacgatttccgaatgaatatatggtggagagggaaggatatgccggagaaacgttcgttctttgctaccgggtc |
35500051 |
T |
 |
| Q |
218 |
gggttacgatcgtgtttttgttgctggtggacatgatgagaataagaacgcgttgaagactgcttgggcttatgacccgaaaattgatgaatggacgatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35500050 |
gggttacgatcgtgtttttgttgctggtggacatgatgagaataagaacgcgttgaagactgcttgggcttatgacccgaaaattgatgaatggacgatg |
35499951 |
T |
 |
| Q |
318 |
ctggctccgatgagtcaagaccgagacgagtgtgaaggaacggttgtcggcggcgagttttgggtggttagcggttatgcgacggagagtcaagggatgt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35499950 |
ctggctccgatgagtcaagaccgagacgagtgtgaaggaacggttgtcggcggcgagttttgggtggttagcggttatgcgacggagagtcaagggatgt |
35499851 |
T |
 |
| Q |
418 |
ttgatgattctgcggaggttttggatattgggtcgggcc |
456 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35499850 |
ttgatgattctgcggaggtgctggatattgggtcgggcc |
35499812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University