View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8382_low_18 (Length: 321)
Name: NF8382_low_18
Description: NF8382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8382_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 20 - 309
Target Start/End: Original strand, 33600139 - 33600428
Alignment:
| Q |
20 |
cttcacaaatcagaacaaagctggcagagtttggcatgactatgttgctgaaagtatgcatgaactttatcccaaagtatttaagagtgctttcacccag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600139 |
cttcacaaatcagaacaaagctggcagagtttggcatgactatgttgctgaaagtatgcatgaactttatcccaaagtatttaagagtgctttcacccag |
33600238 |
T |
 |
| Q |
120 |
taatacacataagcatctccttcttgatagtagattggagccaagacaaaacaatttggtcctgttgctcccaagcatcaagttctggtgtaacgcaatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33600239 |
taatacacataagcatctccttcttgatagtagattggagccaagacaaaacaatttggtcctgttgctcccaagcatcaagttctggcgtaacgcaatt |
33600338 |
T |
 |
| Q |
220 |
tgcgtccacatcttcaagagttctgaatttggaaggatttgaaggattgatcaagaaatgatgcaacttatgtgctttactcacaggttc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33600339 |
tgcgtccacatcttcaagagttctgaatttggaaggatttgaaggattgatcaagaaatgatgcaacttatgtgctttactcataggttc |
33600428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University