View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8383_high_14 (Length: 319)

Name: NF8383_high_14
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8383_high_14
NF8383_high_14
[»] chr2 (2 HSPs)
chr2 (1-131)||(27162226-27162356)
chr2 (249-293)||(27162064-27162108)
[»] chr5 (2 HSPs)
chr5 (3-131)||(20955834-20955962)
chr5 (249-293)||(20956080-20956124)
[»] chr1 (4 HSPs)
chr1 (1-131)||(1976990-1977120)
chr1 (1-131)||(1984356-1984486)
chr1 (249-295)||(1984189-1984235)
chr1 (249-293)||(1976825-1976869)
[»] scaffold0764 (2 HSPs)
scaffold0764 (17-128)||(3108-3219)
scaffold0764 (256-306)||(2936-2986)
[»] scaffold0313 (4 HSPs)
scaffold0313 (17-128)||(3396-3507)
scaffold0313 (17-128)||(17553-17664)
scaffold0313 (256-306)||(3629-3679)
scaffold0313 (256-306)||(17786-17836)
[»] scaffold1531 (1 HSPs)
scaffold1531 (6-128)||(1150-1272)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 27162356 - 27162226
Alignment:
1 tcctgaaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
27162356 tcctgaaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatataaatcttttccaagatattgctgaaaatgca 27162257  T
101 aaggaaatccttcagcaaaatgcagaagatc 131  Q
    |||||||||||||||||||||||||||||||    
27162256 aaggaaatccttcagcaaaatgcagaagatc 27162226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 293
Target Start/End: Complemental strand, 27162108 - 27162064
Alignment:
249 ttgctgcaatctctgaagaggaacttcagaatgttgactcaactg 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
27162108 ttgctgcaatctctgaagaggaacttcagaatgttgactcaactg 27162064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 3 - 131
Target Start/End: Original strand, 20955834 - 20955962
Alignment:
3 ctgaaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgcaaa 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
20955834 ctgaaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaatcctctgatgtaaatcttttccaagatattgctgaaaatgcaaa 20955933  T
103 ggaaatccttcagcaaaatgcagaagatc 131  Q
    |||||||||||||||||||||||||||||    
20955934 ggaaatccttcagcaaaatgcagaagatc 20955962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 293
Target Start/End: Original strand, 20956080 - 20956124
Alignment:
249 ttgctgcaatctctgaagaggaacttcagaatgttgactcaactg 293  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
20956080 ttgctgcaatctctgaagaggaacttcagaatgttgactcaactg 20956124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 1977120 - 1976990
Alignment:
1 tcctgaaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgca 100  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1977120 tcctgaaaaggaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatctttttcaagatattgctgaaaatgca 1977021  T
101 aaggaaatccttcagcaaaatgcagaagatc 131  Q
    ||||||||||| || ||||||||||||||||    
1977020 aaggaaatcctgcaacaaaatgcagaagatc 1976990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 1984486 - 1984356
Alignment:
1 tcctgaaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgca 100  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1984486 tcctgaaaaggaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatctttttcaagatattgctgaaaatgca 1984387  T
101 aaggaaatccttcagcaaaatgcagaagatc 131  Q
    ||||||||||| || ||||||||||||||||    
1984386 aaggaaatcctgcaacaaaatgcagaagatc 1984356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 295
Target Start/End: Complemental strand, 1984235 - 1984189
Alignment:
249 ttgctgcaatctctgaagaggaacttcagaatgttgactcaactgat 295  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||    
1984235 ttgctgcaatttctgaagaggaacttcagaatgttgactcaactgat 1984189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 293
Target Start/End: Complemental strand, 1976869 - 1976825
Alignment:
249 ttgctgcaatctctgaagaggaacttcagaatgttgactcaactg 293  Q
    |||||||||| ||||||||||||||||||||||||||||||||||    
1976869 ttgctgcaatttctgaagaggaacttcagaatgttgactcaactg 1976825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0764 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: scaffold0764
Description:

Target: scaffold0764; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 3219 - 3108
Alignment:
17 tctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgcaaaggaaatccttcagc 116  Q
    |||||||| || || |||||||||||||||||||| | ||||||| ||| ||| ||||| ||||||||||||||||||  |||||| |||||||||||      
3219 tctgatgaagagatagctgattccccaccaaaggaggatgaacccactgctgttaatctcttccaagatattgctgaacgtgcaaaagaaatccttcaag 3120  T
117 aaaatgcagaag 128  Q
    || |||||||||    
3119 aagatgcagaag 3108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0764; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 306
Target Start/End: Complemental strand, 2986 - 2936
Alignment:
256 aatctctgaagaggaacttcagaatgttgactcaactgatgttactgatgt 306  Q
    |||||||||| |||| |||||||| ||||||||||||| |||| |||||||    
2986 aatctctgaaaaggaccttcagaaagttgactcaactggtgttgctgatgt 2936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0313 (Bit Score: 52; Significance: 8e-21; HSPs: 4)
Name: scaffold0313
Description:

Target: scaffold0313; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 3396 - 3507
Alignment:
17 tctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgcaaaggaaatccttcagc 116  Q
    |||||||| || || |||||||||||||||||||| | ||||||| ||| ||| ||||| ||||||||||||||||||  |||||| |||||||||||      
3396 tctgatgaagagatagctgattccccaccaaaggaggatgaacccactgctgttaatctcttccaagatattgctgaacgtgcaaaagaaatccttcaag 3495  T
117 aaaatgcagaag 128  Q
    || |||||||||    
3496 aagatgcagaag 3507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0313; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 17 - 128
Target Start/End: Original strand, 17553 - 17664
Alignment:
17 tctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgcaaaggaaatccttcagc 116  Q
    |||||||| || || |||||||||||||||||||| | ||||||| ||| ||| ||||| ||||||||||||||||||  |||||| |||||||||||      
17553 tctgatgaagagatagctgattccccaccaaaggaggatgaacccactgctgttaatctcttccaagatattgctgaacgtgcaaaagaaatccttcaag 17652  T
117 aaaatgcagaag 128  Q
    || |||||||||    
17653 aagatgcagaag 17664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0313; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 306
Target Start/End: Original strand, 3629 - 3679
Alignment:
256 aatctctgaagaggaacttcagaatgttgactcaactgatgttactgatgt 306  Q
    |||||||||| |||| |||||||| ||||||||||||| |||| |||||||    
3629 aatctctgaaaaggaccttcagaaagttgactcaactggtgttgctgatgt 3679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0313; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 306
Target Start/End: Original strand, 17786 - 17836
Alignment:
256 aatctctgaagaggaacttcagaatgttgactcaactgatgttactgatgt 306  Q
    |||||||||| |||| |||||||| ||||||||||||| |||| |||||||    
17786 aatctctgaaaaggaccttcagaaagttgactcaactggtgttgctgatgt 17836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1531 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold1531
Description:

Target: scaffold1531; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 128
Target Start/End: Original strand, 1150 - 1272
Alignment:
6 aaaaagaagagtctgatgatgaaatggctgattccccaccaaaggatggtgaaccctctgatgtaaatcttttccaagatattgctgaaaatgcaaagga 105  Q
    |||||||||  ||| ||||||| |||||||| || |||| |||||||||||||||| ||| ||| ||||| |||||||  |||||||||  |||||  ||    
1150 aaaaagaagcatctaatgatgagatggctgactctccactaaaggatggtgaacccactgctgttaatctcttccaaggaattgctgaacgtgcaagaga 1249  T
106 aatccttcagcaaaatgcagaag 128  Q
    ||||||||| |||||||||||||    
1250 aatccttcaacaaaatgcagaag 1272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University