View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8383_low_22 (Length: 297)
Name: NF8383_low_22
Description: NF8383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8383_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 86 - 174
Target Start/End: Complemental strand, 26875496 - 26875408
Alignment:
| Q |
86 |
agctcgtctattgattcctccttatagcagacaatatggctggttttttcccaacctttattctcacgatcattcactgttttgctact |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26875496 |
agctcgtctattgattcctccttatagcagacaatatggttggtttttttccaacctttattctcacgatcattcactgttttgctact |
26875408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University